shRNA Lentivirus (self-inactivating), pU6-(LIMS2-shRNA-Seq2)(CAT#: LV-SI0150WQ)

This product is a LIMS2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LIMS2 gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The expression of LIMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LIMS2-shRNA-Seq2
Related Target/Protein LIMS2
Region 3UTR
TargetSeq CCTCCCTTTCTCTTTCCTCAT
NCBI RefSeq NM_017980
Alternative Names LGMD2W; PINCH2; MDRCMTT; PINCH-2
Titer >1*10^10 GC/mL
Related Diseases Muscular dystrophy, severe cardiomyopathy and triangular tongues
Target Gene
Gene ID 55679
Uniprot ID Q7Z4I7

Related Products