shRNA Lentivirus (self-inactivating), pU6-(LOC440993-shRNA-Seq2)(CAT#: LV-SI0501WQ)
This product is a LOC440993-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of LOC440993-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LOC440993-shRNA-Seq2 |
| Related Target/Protein | LOC440993 |
| Region | CDS |
| TargetSeq | GATTCCACCTACAGCAAAGCT |
| NCBI RefSeq | NM_001013714 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung cancer |
