shRNA Lentivirus (self-inactivating), pU6-(LRRC47-shRNA-Seq2)(CAT#: LV-SI0446WQ)
This product is a LRRC47-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LRRC47 gene encodes a protein that significantly changed phosphorylation state in response to short-term vasopressin treatment. The expression of LRRC47-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LRRC47-shRNA-Seq2 |
Related Target/Protein | LRRC47 |
Region | CDS |
TargetSeq | CCCACCAATAACCAACAGTGA |
NCBI RefSeq | NM_020710 |
Titer | >1*10^10 GC/mL |
Related Diseases | Short-term vasopressin |