shRNA Lentivirus (self-inactivating), pU6-(Mvp-shRNA-Seq1)(CAT#: LV-SI2330WQ)
This product is a Mvp-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Mvp gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The expression of Mvp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Mvp-shRNA-Seq1 |
Related Target/Protein | Mvp |
Region | CDS |
TargetSeq | GTGGAAGTCGTGGAGATCATT |
NCBI RefSeq | NM_080638 |
Alternative Names | LRP; VAULT1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |