shRNA Lentivirus (self-inactivating), pU6-(Nudcd1-shRNA-Seq3)(CAT#: LV-SI1851WQ)

This product is a Nudcd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Nudcd1 gene may be a suitable target for antigen-specific immunotherapy. The expression of Nudcd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Nudcd1-shRNA-Seq3
Related Target/Protein Nudcd1
Region CDS
TargetSeq GAGTAAATACGGAGAATTAAT
NCBI RefSeq NM_026149
Alternative Names CML66; OVA66
Titer >1*10^10 GC/mL
Related Diseases Solid tumors
Target Gene
Gene ID 84955
Uniprot ID Q96RS6

Related Products