shRNA Lentivirus (self-inactivating), pU6-(Olfr169-shRNA-Seq1)(CAT#: LV-SI2259WQ)
This product is a Olfr169-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr169 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr169-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Olfr169-shRNA-Seq1 |
| Related Target/Protein | Olfr169 |
| Region | CDS |
| TargetSeq | CACACTATGAACGAGGCGTTT |
| NCBI RefSeq | NM_001011855 |
| Alternative Names | MOR273-3P |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Olfactory dysfunction |
