shRNA Lentivirus (self-inactivating), pU6-(OR51A2-shRNA-Seq5)(CAT#: LV-SI1657WQ)

This product is a OR51A2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR51A2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR51A2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR51A2-shRNA-Seq5
Related Target/Protein OR51A2
Region CDS
TargetSeq GTACCGGGAATTGCATCCAAA
NCBI RefSeq XM_377159
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 401667
Uniprot ID Q8NGJ7

Related Products