shRNA Lentivirus (self-inactivating), pU6-(OR6B2-shRNA-Seq4)(CAT#: LV-SI1685WQ)

This product is a OR6B2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR6B2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR6B2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR6B2-shRNA-Seq4
Related Target/Protein OR6B2
Region CDS
TargetSeq CTCCATGTCTTTCCTGGAGAT
NCBI RefSeq XM_371606
Alternative Names OR2-1; OR6B2P
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 389090
Uniprot ID Q6IFH4

Related Products