shRNA Lentivirus (self-inactivating), pU6-(PRR14-shRNA-Seq1)(CAT#: LV-SI0432WQ)

This product is a PRR14-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by PRR14 gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The expression of PRR14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PRR14-shRNA-Seq1
Related Target/Protein PRR14
Region CDS
TargetSeq CGATTCAGAATACGCAGAACA
NCBI RefSeq NM_024031
Titer >1*10^10 GC/mL
Related Diseases Lung cancer
Target Gene
Gene ID 78994
Uniprot ID Q9BWN1

Related Products