shRNA Lentivirus (self-inactivating), pU6-(PRRC2A-shRNA-Seq1)(CAT#: LV-SI0393WQ)

This product is a PRRC2A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PRRC2A gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. The expression of PRRC2A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PRRC2A-shRNA-Seq1
Related Target/Protein PRRC2A
Region CDS
TargetSeq CCTCGCTCAACCTGTTTGATA
NCBI RefSeq NM_004638
Alternative Names G2; BAT2; D6S51; D6S51E
Titer >1*10^10 GC/mL
Related Diseases Insulin-dependent diabetes mellitus (IDDM)
Target Gene
Gene ID 7916
Uniprot ID P48634

Related Products