shRNA Lentivirus (self-inactivating), pU6-(PRRC2A-shRNA-Seq2)(CAT#: LV-SI0394WQ)
This product is a PRRC2A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PRRC2A gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. The expression of PRRC2A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | PRRC2A-shRNA-Seq2 |
Related Target/Protein | PRRC2A |
Region | CDS |
TargetSeq | CCACAATCCAAGAACCTGGAT |
NCBI RefSeq | NM_004638 |
Alternative Names | G2; BAT2; D6S51; D6S51E |
Titer | >1*10^10 GC/mL |
Related Diseases | Insulin-dependent diabetes mellitus (IDDM) |