shRNA Lentivirus (self-inactivating), pU6-(SFTA2-shRNA-Seq1)(CAT#: LV-SI0077WQ)
This product is a SFTA2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SFTA2 is a novel secretory peptide highly expressed in the lung. The expression of SFTA2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SFTA2-shRNA-Seq1 |
| Related Target/Protein | SFTA2 |
| Region | CDS |
| TargetSeq | CGGGTATGACTTTGCAACTGA |
| NCBI RefSeq | NM_205854 |
| Alternative Names | SP-G; SFTPG; UNQ541; GSGL541 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung cancer |
