shRNA Lentivirus (self-inactivating), pU6-(SH3D19-shRNA-Seq2)(CAT#: LV-SI0277WQ)

This product is a SH3D19-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SH3D19 gene encoded protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. The expression of SH3D19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SH3D19-shRNA-Seq2
Related Target/Protein SH3D19
Region 3UTR
TargetSeq GCCAAATAGGTTGAAGACAAT
NCBI RefSeq NM_001009555
Alternative Names EBP; EVE1; Kryn; Eve-1; SH3P19
Titer >1*10^10 GC/mL
Related Diseases Acute myeloid leukemia
Target Gene
Gene ID 152503
Uniprot ID Q5HYK7

Related Products