shRNA Lentivirus (self-inactivating), pU6-(SNRNP70-shRNA-Seq5)(CAT#: LV-SI0015WQ)
This product is a SNRNP70-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SNRNP70 is the component of the spliceosomal U1 snRNP, which is essential for recognition of the pre-mRNA 5' splice-site and the subsequent assembly of the spliceosome. Misregulation of this gene has been implicated in the mRNA splicing-major pathway. The expression of SNRNP70-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SNRNP70-shRNA-Seq5 |
| Related Target/Protein | SNRNP70 |
| Region | CDS |
| TargetSeq | GACATGCACTCCGCTTACAAA |
| NCBI RefSeq | NM_003089 |
| Alternative Names | RPU1; Snp1; U1AP; U170K; U1RNP; RNPU1Z; SNRP70; U1-70K |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Alzheimer's Disease, Mixed Connective Tissue Disease and Systemic Lupus Erythematosus |
