shRNA Lentivirus (self-inactivating), pU6-(SPAM1-shRNA-Seq2)(CAT#: LV-SI1507WQ)
This product is a SPAM1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPAM1 gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. The expression of SPAM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SPAM1-shRNA-Seq2 |
Related Target/Protein | SPAM1 |
Region | CDS |
TargetSeq | GCAAGGAGTGTGTATAAGGAA |
NCBI RefSeq | NM_003117 |
Alternative Names | HYA1; PH20; HYAL1; HYAL3; HYAL5; PH-20; SPAG15; HEL-S-96n |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |