shRNA Lentivirus (self-inactivating), pU6-(Trmt1-shRNA-Seq3)(CAT#: LV-SI2005WQ)
This product is a Trmt1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Trmt1 gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The expression of Trmt1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Trmt1-shRNA-Seq3 |
Related Target/Protein | Trmt1 |
Region | CDS |
TargetSeq | GTAGAGCTTATGCACAGAAAT |
NCBI RefSeq | NM_198020 |
Alternative Names | TRM1; MRT68 |
Titer | >1*10^10 GC/mL |
Related Diseases | Autosomal recessive intellectual disorder (ARID) |