shRNA Lentivirus (self-inactivating), pU6-(Trmt1-shRNA-Seq3)(CAT#: LV-SI2005WQ)
This product is a Trmt1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Trmt1 gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The expression of Trmt1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Trmt1-shRNA-Seq3 |
| Related Target/Protein | Trmt1 |
| Region | CDS |
| TargetSeq | GTAGAGCTTATGCACAGAAAT |
| NCBI RefSeq | NM_198020 |
| Alternative Names | TRM1; MRT68 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Autosomal recessive intellectual disorder (ARID) |
