shRNA Lentivirus (self-inactivating), pU6-(Zcchc5-shRNA-Seq1)(CAT#: LV-SI2218WQ)
This product is a Zcchc5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Zcchc5 gene is a member of a family of gag-related retrotransposon genes. These genes appear to have lost the ability to retrotranspose. The expression of Zcchc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Zcchc5-shRNA-Seq1 |
| Related Target/Protein | Zcchc5 |
| Region | CDS |
| TargetSeq | CCACCAACCTATCTGATGTGA |
| NCBI RefSeq | NM_199468 |
| Alternative Names | Mar3; ZHC5; Mart3; SIRH9; ZCCHC5; RTL3 |
| Titer | >1*10^10 GC/mL |
