shRNA Adeno-associated Virus Serotype 2, p7SK-(2700050L05Rik-shRNA-Seq1)(CAT#: AAV-SI3942WQ)

This product is a 2700050L05Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The 2700050L05Rik gene has the ability to positive regulation of transcription. The expression of 2700050L05Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 2700050L05Rik-shRNA-Seq1
Related Target/Protein 2700050L05Rik
Region 3UTR
TargetSeq CGGTGCTGAGACTTATTAAAT
NCBI RefSeq NM_178115
Alternative Names AU022667; AW558805; Edrf1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 214764
Uniprot ID E9Q9F9

Related Products

Inquiry Now
Advertisement