shRNA Adeno-associated Virus Serotype 2, p7SK-(2700062C07Rik-shRNA-Seq1)(CAT#: AAV-SI3924WQ)
This product is a 2700062C07Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2700062C07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | 2700062C07Rik-shRNA-Seq1 |
Related Target/Protein | 2700062C07Rik |
Region | CDS |
TargetSeq | GAAACACTTCTCTCAACTAAA |
NCBI RefSeq | NM_026529 |
Alternative Names | C87515; AI195775 |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 68046 |
Uniprot ID | A0A3Q4EGR9 |