shRNA Adeno-associated Virus Serotype 2, p7SK-(6030498E09Rik-shRNA-Seq1)(CAT#: AAV-SI3607WQ)

This product is a 6030498E09Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 6030498E09Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 6030498E09Rik-shRNA-Seq1
Related Target/Protein 6030498E09Rik
Region 3UTR
TargetSeq CCATAGAAATGCCACATTTAA
NCBI RefSeq NM_183126
Titer >1*10^10 GC/mL
Target Gene
Gene ID 77883
Uniprot ID B1AX85

Related Products

Inquiry Now
Advertisement