shRNA Adeno-associated Virus Serotype 2, p7SK-(A130030D10Rik-shRNA-Seq1)(CAT#: AAV-SI3945WQ)

This product is a A130030D10Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by A130030D10Rik gene may play a role in Shh signaling by mediating the ubiquitination of Kif7. The expression of A130030D10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert A130030D10Rik-shRNA-Seq1
Related Target/Protein A130030D10Rik
Region 3UTR
TargetSeq CGCTAACACTTTGCTGTATTT
NCBI RefSeq NM_177783
Alternative Names Zfp650; Znf650; AA409735; AA414972; AA422631; AI646861; AU016126; 1110059H15Rik; 4833421P10Rik; Ubr3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 68795
Uniprot ID Q5U430

Related Products

Inquiry Now
Advertisement