shRNA Adeno-associated Virus Serotype 2, p7SK-(Agpat4-shRNA-Seq5)(CAT#: AAV-SI3471WQ)
This product is a Agpat4-shRNA encoding AAV, which is based on AAV-2 serotype. The Agpat4 gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family and this integral membrane protein converts lysophosphatidic acid to phosphatidic acid. The expression of Agpat4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Agpat4-shRNA-Seq5 |
Related Target/Protein | Agpat4 |
Region | CDS |
TargetSeq | CCTCAATCACAAGTTTGAGAT |
NCBI RefSeq | NM_026644 |
Alternative Names | 1-AGPAT4; dJ473J16.2; LPAAT-delta |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |