shRNA Adeno-associated Virus Serotype 2, p7SK-(Arl10-shRNA-Seq1)(CAT#: AAV-SI3948WQ)

This product is a Arl10-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Arl10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Arl10-shRNA-Seq1
Related Target/Protein Arl10
Region CDS
TargetSeq CTTTATCCTCTGGAAAGCTTA
NCBI RefSeq NM_019968
Alternative Names ARL10A
Titer >1*10^10 GC/mL
Related Diseases Chromosome segregation
Target Gene
Gene ID 285598
Uniprot ID Q8N8L6

Related Products