shRNA Adeno-associated Virus Serotype 2, p7SK-(Armc5-shRNA-Seq1)(CAT#: AAV-SI4034WQ)
This product is a Armc5-shRNA encoding AAV, which is based on AAV-2 serotype. The Armc5 gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. The expression of Armc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Armc5-shRNA-Seq1 |
Related Target/Protein | Armc5 |
Region | 3UTR |
TargetSeq | CCAGGATGAAGATCTAACGAT |
NCBI RefSeq | NM_146205 |
Alternative Names | AIMAH2 |
Titer | >1*10^10 GC/mL |
Related Diseases | ACTH-independent macronodular adrenal hyperplasia 2 |