shRNA Adeno-associated Virus Serotype 2, p7SK-(C030018G13Rik-shRNA-Seq1)(CAT#: AAV-SI4007WQ)

This product is a C030018G13Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by C030018G13Rik gene is component of the NALCN sodium channel complex, required for channel regulation. The expression of C030018G13Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C030018G13Rik-shRNA-Seq1
Related Target/Protein C030018G13Rik
Region CDS
TargetSeq GCTCTCCAATCAACAGTCAGA
NCBI RefSeq NM_175510
Alternative Names UNC-80; Unc80; C230061B10Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 329178
Uniprot ID Q8BLN6

Related Products

Advertisement