shRNA Adeno-associated Virus Serotype 2, p7SK-(C10orf67-shRNA-Seq2)(CAT#: AAV-SI1269WQ)

This product is a C10orf67-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C10orf67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C10orf67-shRNA-Seq2
Related Target/Protein C10orf67
Region CDS
TargetSeq CATTATCAACAGAATGAGGAT
NCBI RefSeq NM_153714
Alternative Names C10orf115; LINC01552
Titer >1*10^10 GC/mL
Related Diseases Sarcoidosis and Crohn's disease
Target Gene
Gene ID 256815
Uniprot ID Q8IYJ2

Related Products

Advertisement