shRNA Adeno-associated Virus Serotype 2, p7SK-(C12orf48-shRNA-Seq1)(CAT#: AAV-SI1274WQ)
This product is a C12orf48-shRNA encoding AAV, which is based on AAV-2 serotype. The C12orf48 is required to suppress inappropriate homologous recombination, thereby playing a central role DNA repair and in the maintenance of genomic stability. The expression of C12orf48-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | C12orf48-shRNA-Seq1 |
Related Target/Protein | C12orf48 |
Region | CDS |
TargetSeq | CAAACTAGCTAAAGTAGCAAA |
NCBI RefSeq | NM_017915 |
Alternative Names | AROM; PARI; PARPBP |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular Carcinoma |