shRNA Adeno-associated Virus Serotype 2, p7SK-(C12orf48-shRNA-Seq2)(CAT#: AAV-SI1275WQ)

This product is a C12orf48-shRNA encoding AAV, which is based on AAV-2 serotype. The C12orf48 is required to suppress inappropriate homologous recombination, thereby playing a central role DNA repair and in the maintenance of genomic stability. The expression of C12orf48-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C12orf48-shRNA-Seq2
Related Target/Protein C12orf48
Region CDS
TargetSeq GAGGGTGTAAATCCATCTGTT
NCBI RefSeq NM_017915
Alternative Names AROM; PARI; PARPBP
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular Carcinoma
Target Gene
Gene ID 55010
Uniprot ID Q9NWS1

Related Products

Advertisement