shRNA Adeno-associated Virus Serotype 2, p7SK-(C3orf37-shRNA-Seq2)(CAT#: AAV-SI1408WQ)
This product is a C3orf37-shRNA encoding AAV, which is based on AAV-2 serotype. The C3orf37 gene acts as an enzyme that recognizes and binds abasic sites in ssDNA at replication forks and chemically modifies the lesion by forming a covalent cross-link with DNA. The expression of C3orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | C3orf37-shRNA-Seq2 |
Related Target/Protein | C3orf37 |
Region | CDS |
TargetSeq | GAGGCAGTTTCTAAATGGCTT |
NCBI RefSeq | NM_020187 |
Alternative Names | DC12; SRAPD1; HMCES |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA demethylation |