shRNA Adeno-associated Virus Serotype 2, p7SK-(C6orf165-shRNA-Seq3)(CAT#: AAV-SI1465WQ)
This product is a C6orf165-shRNA encoding AAV, which is based on AAV-2 serotype. The C6orf165 gene may regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C6orf165-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | C6orf165-shRNA-Seq3 |
Related Target/Protein | C6orf165 |
Region | 3UTR |
TargetSeq | GTCTCAAACTTGTGGCTTCAA |
NCBI RefSeq | NM_178823 |
Alternative Names | CFAP206; dJ382I10.1 |
Titer | >1*10^10 GC/mL |