shRNA Adeno-associated Virus Serotype 2, p7SK-(C6orf165-shRNA-Seq3)(CAT#: AAV-SI1465WQ)

This product is a C6orf165-shRNA encoding AAV, which is based on AAV-2 serotype. The C6orf165 gene may regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C6orf165-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C6orf165-shRNA-Seq3
Related Target/Protein C6orf165
Region 3UTR
TargetSeq GTCTCAAACTTGTGGCTTCAA
NCBI RefSeq NM_178823
Alternative Names CFAP206; dJ382I10.1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 154313
Uniprot ID Q8IYR0

Related Products