shRNA Adeno-associated Virus Serotype 2, p7SK-(CABIN1-shRNA-Seq4)(CAT#: AAV-SI1232WQ)
This product is a CABIN1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by CABIN1 gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The expression of CABIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CABIN1-shRNA-Seq4 |
Related Target/Protein | CABIN1 |
Region | CDS |
TargetSeq | CCGCCACAACTATTATCACCT |
NCBI RefSeq | NM_012295 |
Alternative Names | CAIN; PPP3IN; KB-318B8.7 |
Titer | >1*10^10 GC/mL |
Related Diseases | Glomerular podocyte injury |