shRNA Adeno-associated Virus Serotype 2, p7SK-(CDCA3-shRNA-Seq3)(CAT#: AAV-SI1126WQ)
This product is a CDCA3-shRNA encoding AAV, which is based on AAV-2 serotype. CDCA3 is a potential prognostic marker that promotes cell proliferation in gastric cancer. CDCA3 overexpression resulted in the stimulation of cell growth and colony formation in vitro and xenograft tumors in vivo. Conversely, knockdown of CDCA3 inhibited these effects. The expression of CDCA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CDCA3-shRNA-Seq3 |
Related Target/Protein | CDCA3 |
Region | CDS |
TargetSeq | CTCCCAGATCTTCAGGTTCTA |
NCBI RefSeq | NM_031299 |
Alternative Names | GRCC8; TOME-1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Gastric cancer |