shRNA Adeno-associated Virus Serotype 2, p7SK-(Cenpc1-shRNA-Seq3)(CAT#: AAV-SI3441WQ)

This product is a Cenpc1-shRNA encoding AAV, which is based on AAV-2 serotype. The Cenpc1 gene is a centromere autoantigen and a component of the inner kinetochore plate. The encoded protein is required for maintaining proper kinetochore size and a timely transition to anaphase. The expression of Cenpc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Cenpc1-shRNA-Seq3
Related Target/Protein Cenpc1
Region CDS
TargetSeq GATGTCCAATCACGTTCTAAG
NCBI RefSeq NM_007683
Alternative Names MIF2; hcp-4; CENP-C; CENPC
Titer >1*10^10 GC/mL
Target Gene
Gene ID 1060
Uniprot ID Q03188

Related Products

Inquiry Now
Advertisement