shRNA Adeno-associated Virus Serotype 2, p7SK-(CHRDL2-shRNA-Seq3)(CAT#: AAV-SI3228WQ)

This product is a CHRDL2-shRNA encoding AAV, which is based on AAV-2 serotype. The CHRDL2 gene encodes a member of the chordin family of proteins. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. The expression of CHRDL2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CHRDL2-shRNA-Seq3
Related Target/Protein CHRDL2
Region CDS
TargetSeq CAGGAAGCAAGACTTCCAGAA
NCBI RefSeq NM_015424
Alternative Names BNF1; CHL2
Titer >1*10^10 GC/mL
Related Diseases osteoarthritis
Target Gene
Gene ID 25884
Uniprot ID Q6WN34

Related Products

Advertisement