shRNA Adeno-associated Virus Serotype 2, p7SK-(CLMP-shRNA-Seq2)(CAT#: AAV-SI1100WQ)

This product is a CLMP-shRNA encoding AAV, which is based on AAV-2 serotype. The CLMP gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. The expression of CLMP-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CLMP-shRNA-Seq2
Related Target/Protein CLMP
Region CDS
TargetSeq CAGAAGGAAGTGACCTGACTT
NCBI RefSeq NM_024769
Alternative Names ACAM; ASAM; CSBM; CSBS
Titer >1*10^10 GC/mL
Related Diseases Congenital short bowel syndrome
Target Gene
Gene ID 79827
Uniprot ID Q9H6B4

Related Products

Inquiry Now
Advertisement