shRNA Adeno-associated Virus Serotype 2, p7SK-(CXXC4-shRNA-Seq1)(CAT#: AAV-SI1176WQ)
This product is a CXXC4-shRNA encoding AAV, which is based on AAV-2 serotype. The CXXC4 gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The expression of CXXC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CXXC4-shRNA-Seq1 |
Related Target/Protein | CXXC4 |
Region | CDS |
TargetSeq | CCGTCGTTGCAAATGGCAAAT |
NCBI RefSeq | NM_025212 |
Alternative Names | IDAX |
Titer | >1*10^10 GC/mL |
Related Diseases | Renal carcinoma |