shRNA Adeno-associated Virus Serotype 2, p7SK-(D730001G18Rik-shRNA-Seq1)(CAT#: AAV-SI4049WQ)

This product is a D730001G18Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by D730001G18Rik has acetylcholine receptor inhibitor activity. The expression of D730001G18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert D730001G18Rik-shRNA-Seq1
Related Target/Protein D730001G18Rik
Region CDS
TargetSeq CCTCTATGAGACCTTCAGAGT
NCBI RefSeq NM_172433
Alternative Names Ly6g6g
Titer >1*10^10 GC/mL
Target Gene
Gene ID 78725
Uniprot ID A0A087WQU7

Related Products

Inquiry Now
Advertisement