shRNA Adeno-associated Virus Serotype 2, p7SK-(DDX3X-shRNA-Seq3)(CAT#: AAV-SI1005WQ)
This product is a DDX3X-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DDX3X has ATP-dependent RNA helicase activity and display a high level of RNA-independent ATPase activity. Misregulation of this gene has been implicated in tumorigenesis and alternative splicing results in multiple transcript variants. The expression of DDX3X-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | DDX3X-shRNA-Seq3 |
Related Target/Protein | DDX3X |
Region | CDS |
TargetSeq | CGTAGAATAGTCGAACAAGAT |
NCBI RefSeq | NM_001356 |
Alternative Names | DBX; DDX3; HLP2; DDX14; CAP-Rf; MRX102 |
Titer | >1*10^10 GC/mL |
Related Diseases | X-linked recessive inheritance |