shRNA Adeno-associated Virus Serotype 2, p7SK-(DHX15-shRNA-Seq1)(CAT#: AAV-SI1008WQ)

This product is a DHX15-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DHX15 is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. Misregulation of this gene has been implicated in tumorigenesis. The expression of DHX15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DHX15-shRNA-Seq1
Related Target/Protein DHX15
Region 3UTR
TargetSeq GTTGGTTCGATAATGGCCTTT
NCBI RefSeq NM_001358
Alternative Names DBP1; HRH2; DDX15; PRP43; PRPF43; PrPp43p
Titer >1*10^10 GC/mL
Related Diseases Acute myeloid leukemia (AML)
Target Gene
Gene ID 1665
Uniprot ID O43143

Related Products

Advertisement