shRNA Adeno-associated Virus Serotype 2, p7SK-(DHX15-shRNA-Seq3)(CAT#: AAV-SI1010WQ)
This product is a DHX15-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DHX15 is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. Misregulation of this gene has been implicated in tumorigenesis. The expression of DHX15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | DHX15-shRNA-Seq3 |
Related Target/Protein | DHX15 |
Region | CDS |
TargetSeq | TGGGAATACAAGGATAGGTTT |
NCBI RefSeq | NM_001358 |
Alternative Names | DBP1; HRH2; DDX15; PRP43; PRPF43; PrPp43p |
Titer | >1*10^10 GC/mL |
Related Diseases | Acute myeloid leukemia (AML) |