shRNA Adeno-associated Virus Serotype 2, p7SK-(DKFZp434P055-shRNA-Seq2)(CAT#: AAV-SI1330WQ)

This product is a DKFZp434P055-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of DKFZp434P055-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DKFZp434P055-shRNA-Seq2
Related Target/Protein DKFZp434P055
Region CDS
TargetSeq GCAAACAAAGCTAGATCACAT
NCBI RefSeq NM_173466
Titer >1*10^10 GC/mL

Related Products