shRNA Adeno-associated Virus Serotype 2, p7SK-(EFCAB4A-shRNA-Seq1)(CAT#: AAV-SI1391WQ)

This product is a EFCAB4A-shRNA encoding AAV, which is based on AAV-2 serotype. The EFCAB4A gene plays a role in store-operated Ca2+ entry (SOCE). The expression of EFCAB4A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert EFCAB4A-shRNA-Seq1
Related Target/Protein EFCAB4A
Region CDS
TargetSeq GCTGTTTCTGCTGTGTGACAA
NCBI RefSeq NM_173584
Alternative Names CRACR2B
Titer >1*10^10 GC/mL
Related Diseases Chronic bronchitis
Target Gene
Gene ID 283229
Uniprot ID Q8N4Y2

Related Products