shRNA Adeno-associated Virus Serotype 2, p7SK-(Eif4h-shRNA-Seq4)(CAT#: AAV-SI3631WQ)
This product is a Eif4h-shRNA encoding AAV, which is based on AAV-2 serotype. The Eif4h gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. The expression of Eif4h-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Eif4h-shRNA-Seq4 |
Related Target/Protein | Eif4h |
Region | CDS |
TargetSeq | GACTTCAGAGAACCCACAGAA |
NCBI RefSeq | NM_033561 |
Alternative Names | WSCR1; WBSCR1; eIF-4H |
Titer | >1*10^10 GC/mL |
Related Diseases | Williams syndrome |