shRNA Adeno-associated Virus Serotype 2, p7SK-(Fads6-shRNA-Seq1)(CAT#: AAV-SI4018WQ)
This product is a Fads6-shRNA encoding AAV, which is based on AAV-2 serotype. This protein encoded by Fads6 gene is involved in the pathway fatty acid metabolism, which is part of Lipid metabolism.The expression of Fads6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Fads6-shRNA-Seq1 |
| Related Target/Protein | Fads6 |
| Region | CDS |
| TargetSeq | CATGAATGTGTCAGGCTTCAA |
| NCBI RefSeq | NM_178035 |
| Alternative Names | FP18279 |
| Titer | >1*10^10 GC/mL |
