shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM45B-shRNA-Seq1)(CAT#: AAV-SI3893WQ)

This product is a FAM45B-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of FAM45B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM45B-shRNA-Seq1
Related Target/Protein FAM45B
Region 3UTR
TargetSeq CGAAGTGCTATAACTACTTTA
NCBI RefSeq NM_018472
Alternative Names HT011; DENND10P1; FAM45BP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55855
Uniprot ID Q6NSW5

Related Products