shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM53C-shRNA-Seq1)(CAT#: AAV-SI3221WQ)
This product is a FAM53C-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by FAM53C gene belongs to the FAM53 protein family. FAM53 protein family members bind to a transcriptional regulator that modulates cell proliferation. Alternative splicing results in multiple transcript variants. The expression of FAM53C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | FAM53C-shRNA-Seq1 |
Related Target/Protein | FAM53C |
Region | 3UTR |
TargetSeq | GCAGCCTATGATTGCTTCTTT |
NCBI RefSeq | NM_016605 |
Alternative Names | C5orf6 |
Titer | >1*10^10 GC/mL |
Related Diseases | Prostate cancer |