shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM70A-shRNA-Seq2)(CAT#: AAV-SI1154WQ)

This product is a FAM70A-shRNA encoding AAV, which is based on AAV-2 serotype. TMEM255A is often referred to as family with sequence similarity 70, member A (FAM70A). The TMEM255A protein is transmembrane and is predicted to be located the nuclear envelope of eukaryote organisms. The expression of FAM70A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM70A-shRNA-Seq2
Related Target/Protein FAM70A
Region CDS
TargetSeq GCCACCATATTCTGCTTATGA
NCBI RefSeq NM_017938
Alternative Names Tmem255a; 4933417N17; 6430550H21Rik
Titer >1*10^10 GC/mL
Related Diseases Glioblastoma multiforme
Target Gene
Gene ID 245386
Uniprot ID Q5JRV8

Related Products

Inquiry Now
Advertisement