shRNA Adeno-associated Virus Serotype 2, p7SK-(FBXL16-shRNA-Seq1)(CAT#: AAV-SI3213WQ)
This product is a FBXL16-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by FBXL16 belongs to the F-box protein family and they interact with ubiquitination targets through other protein interaction domains. The expression of FBXL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | FBXL16-shRNA-Seq1 |
| Related Target/Protein | FBXL16 |
| Region | CDS |
| TargetSeq | CCTGGACATCTGTGAGTTCAT |
| NCBI RefSeq | NM_153350 |
| Alternative Names | Fbl16; C16orf22; c380A1.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Ductal Carcinoma |
