shRNA Adeno-associated Virus Serotype 2, p7SK-(Gaa-shRNA-Seq1)(CAT#: AAV-SI3937WQ)

This product is a Gaa-shRNA encoding AAV, which is based on AAV-2 serotype. The Gaa gene encodes lysosomal alpha-glucosidase, which is essential for the degradation of glycogen to glucose in lysosomes. The expression of Gaa-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Gaa-shRNA-Seq1
Related Target/Protein Gaa
Region 3UTR
TargetSeq CCCTGAAGCTCTGTGTTCTTA
NCBI RefSeq NM_008064
Alternative Names LYAG
Titer >1*10^10 GC/mL
Related Diseases Pompe's disease
Target Gene
Gene ID 2548
Uniprot ID P10253

Related Products

Inquiry Now
Advertisement