shRNA Adeno-associated Virus Serotype 2, p7SK-(GOLM1-shRNA-Seq3)(CAT#: AAV-SI1135WQ)

This product is a GOLM1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by GOLM1 is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. The expression of GOLM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert GOLM1-shRNA-Seq3
Related Target/Protein GOLM1
Region CDS
TargetSeq GAAGGGAAACGTGCTTGGTAA
NCBI RefSeq NM_016548
Alternative Names GP73; HEL46; GOLPH2; C9orf155; PSEC0257; bA379P1.3
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 51280
Uniprot ID Q8NBJ4

Related Products

Advertisement